动物模型 z-bo 2020-12-06 327

　　Background: Cancer metastasis is the process by which cancer cells spread from the primary tumor to one or more other parts of the body. More than 90% of cancer-related deaths are directly related to cancer metastasis. In fact, all cancers can form metastatic tumors, including cancers of the blood and lymphatic system (leukemia, multiple myeloma, and lymphoma). Metastatic tumor cells spread through the two main trunk lymphatics and blood vessels, forming secondary foci in common areas such as the lung, liver, brain, and bones. The current understanding of the development of tumor metastasis mainly comes from mouse models. It is currently known that the formation of a metastasis is a complex molecular cascade. Cancer cells leave the site of the primary tumor (blood vessels), enter the blood or lymphatic vessels (circulation), and spread to distant anatomical sites (arrest and external Infiltration), they can grow secondary tumors at the target organ site (colonization). In this process, a kind of matrix metalloproteinases (MMPs) are used as "molecular scissors" to secrete proteins that inhibit cancer cell migration and movement. The success rate of metastatic cancer cells forming secondary foci in distant organs is very low. The estimated rate from primary tumor cells is 0.01%. The reasons for this low success rate may include the following aspects: (1) Cancer cells are usually closely connected with neighbors and surrounding protein networks, and any other detached cells can lead to cancer cell death (apoptosis); (2) and Compared with other blood cells, cancer cells are usually quite large, and are easily destroyed or stuck when passing through blood vessels, leading to cell death; (3) Cells in the immune system can recognize and destroy highly heterogeneous cancer cells. ; Although some types of metastatic cancer can be cured with current treatments, most cannot. Therefore, the primary task of these therapies is to shrink cancer or slow its growth rate to help alleviate cancer-related symptoms. Circulating tumor cells (CTCs) are cancer cells that have shed from the blood vessels of the primary tumor and circulate in the bloodstream. Some of these CTCs can gain the ability to exude from the blood vessels and continue to parasitize the tumor to spread to distant vital organs and cause most cancer patients to die. In recent decades, many organizations have tried to develop new diagnostic assays for detecting circulating tumor cells in the peripheral blood of tumor patients. Through the application of these cutting-edge technologies, anti-metastatic therapy can block the patient's cancer metastasis. If the metastatic cancer cells can remain dormant, this will make the cancer a chronic but easy-to-control disease. A breakthrough has been made in recent metastasis research. The three types of genes have been divided into metastasis initiation genes, metastasis progress genes and metastasis toxic genes. The acquisition and specificity of their functions enable tumor cells to circulate, target, penetrate and colonize Distant organs. The transfer initiation gene provides an opportunity for primary tumor cells to enter the circulation. These genes have the ability of cell movement, invasion, and angiogenesis, allowing tumor cells to target blood vessels in the microenvironment, enter the circulation, and spread to distant organs. Tumor metastasis genes contribute to the occurrence of primary tumors and play a more beneficial role in the metastatic site. In the process of metastatic colonization, this process serves as the rate-limiting function of the primary tumor growth. The transfer of toxic genes provides selective advantages and aggressiveness to secondary colonization sites. These genes rarely show the "poor prognosis" gene expression characteristics in primary tumors. In addition to these metastatic genes, nearly 30 metastasis suppressor genes have been identified. In this study, our goal is to design a fast and reliable method that uses a combination of bioluminescence imaging and real-time fluorescent quantitative PCR analysis to monitor human circulating tumor cells in mice.

　　Method: Cell culture: Human breast epithelial adenocarcinoma cell line is cultured in DMEM/F12 medium. In a 37°C incubator, incubate with 5% CO2, 10% bovine serum, 100 units/ml penicillin and 100 mg streptomycin.

　　 Transfection and cell line selection: MDA-MB-231 cells were electroporated and transfected with pcDNA3 plasmid to express the firefly luciferase gene. In short, 5×106 cells were washed twice with PBS and 10 μg plasmid was added. After 48 hours, use G418 to select stable cell lines (6 mg/ml). MDA-MB-231 cells are used to study human-luminescent derivatives in vivo.

　　 Animal experiment: Four weeks old severe combined immunodeficiency (SCID) mice, all operations were performed under isoflurane anesthesia, and every effort was made to reduce pain. During the experiment, the mice did not receive the stress or abnormal behavior caused by the tumor. The veterinarian monitors the health of the animals once a day. Food and water are changed every two days.

　　 Bioluminescence (IVIS) and multimodal imaging of tumors: Bioluminescence imaging is a highly sensitive, cooled CCD camera mounted in a light specimen box. In vivo imaging, animals were injected with MDA-MB 231 breast cancer cells (1×105, 104, 103, 102 cells and PBS control group) with stable expression of the numbered luciferase reporter gene through tail vein injection. After 15 minutes, the mice were intraperitoneally injected with D-luciferin (200 mg/kg). The animal was placed on a warm table in the camera box and continuously exposed to 2.5% isoflurane to maintain sedation during imaging. Each group of mice was imaged for 30 seconds. The IVIS camera system detects the integration, digitizes, and displays the light emitted by the mouse.

　　 Orthogonal heterogeneous breast cancer animal model: Using an orthogonal heterogeneous tumor model, immunodeficiency (SCID) mice (6-8 weeks old) are used to simulate human cancer. Five mice were anesthetized with 2% isoflurane, and each breast was implanted with 5×106 MDA-MB-231 cells expressing luciferase. Five mice injected with PBS were used as a control group. All mice were sacrificed 10 weeks after the injection of cancer cells and blood was collected. During the entire study, the room temperature of the mice (21-24 degrees) and the relative humidity were between 43-65%.

　　 Blood sample: 100-150ul of blood is collected by mouse heart puncture and processed according to standard separation protocol. Use the kit to extract DNA from human and mouse leukocytes. The DNA concentration of the sample is at least 10ng/UL.

　　 Real-time quantitative polymerase chain reaction: human GUS primer (forward: AGTGTTCCCTGCTAGAATAGATG reverse: AAACAGCCTGTTTACTTGAG). Mouse GUS primer (forward: GCAGGCTTTCAAGAGTTCA reverse: TATGAGCTGGTCCTCCATTTC). 1 microliter of DNA sample and mix, first denatured at 95°C for 10 minutes, then repeat 40 cycles, denatured at 95°C for 5 seconds, annealed at 60°C for 5, and extended at 72°C for 10 seconds, and the fluorescence intensity was measured. Perform melting curve analysis.

　　Result: IVIS detection of cell number: IVIS imaging system observes the fluorescence, and the cancer cells of transplanted tumor mice are detected by IVIS. We have established a study on the gene expression of MDA-MB-231 breast cancer cells. In short, a plasmid containing luciferase was introduced into MDA-MB-231 breast cancer cells and screened by G418 for one month. IVIS can very sensitively and accurately measure the number of diluted breast cancer cells. The luciferase gradient light ranges from high brightness (red) to low brightness.

　　 Conclusion: Through IVIS and real-time fluorescence quantitative PCR analysis, we can quantify the number of CTCs in the peripheral blood of mice to understand the process of tumor transplantation in the breast. In addition, the information of the three-dimensional CT imaging system greatly improves the recognition rate of early metastases.