骨质疏松 z-bo 2020-12-11 322

　　Introduction: Osteoporosis (OP) is a degenerative bone disease characterized by decreased bone mass, bone microstructure deterioration, and increased risk of fractures. The pathogenesis of OP is related to the imbalance of bone metabolism, including the destruction of bone formation and bone resorption regulated by osteoclasts and osteoblasts. When the bone formation rate is lower than the bone resorption rate, OP plays a role. Drugs used to treat OP include bone resorption inhibitors and bone formation enhancers. Bone resorption inhibitors are the largest class of drugs, including bisphosphonates, hormone replacement therapy (HRT), selective estrogen receptor modulators (SERMS), calcitonin, and RANK ligand inhibitors. These treatments increase bone density (BMD) by inhibiting bone resorption. Bone formation enhancers directly stimulate bone formation and promote the production of collagen and bone matrix by osteoblasts. Many Chinese medicines or compounds have certain effects in these processes, in vitro studies and in vivo rats, including the so-called Liuwei Dihuang, Yinyanghuo, and Danshen. Disease models are very important for drug research and development. However, the cell model is too simplistic to accurately reflect the overall physiology, nor can it provide a lot of information about drug metabolism in the body. The cost and time disadvantages of animal models such as mice limit their application in high-throughput screening. In contrast, zebrafish have several advantages, including their rapid development and small, transparent body. In addition, the developmental signaling pathways and related genes between zebrafish and mammals are highly conserved. The bone development mechanism of vertebrates is evolutionarily conserved. The main pathways related to osteoblast development include Wnt/β-catenin, TGF-β and Hedgehog signaling. Similar to mammals, bone formation in lower vertebrates also has endochondral and intramembranous ossification controlled by a series of transcription factors and hormones. The key regulators involved in zebrafish bone formation include Osterix, Runx2a/b, Col10a1 and osteonectin which are homologous to human bone formation regulators. In general, these common developmental characteristics provide a theoretical basis for using zebrafish as a research model for mature bone diseases. Transgenic technology using reporter genes downstream of tissue-specific promoters can be used to generate fluorescence in specific organs. This technology has been used for gene function research and drug screening at the molecular level of zebrafish. The transgenic zebrafish TG (ola.sp7:nlsGFP) expressing enhanced green fluorescent protein (eGFP) has been used by researchers to study axial bone development. Patients receiving various glucocorticoid treatments sometimes experience OP side effects. In most vertebrates, including mammals, the glucocorticoid system is highly conserved. The same symptoms can also be caused in mice. Glucocorticoids are also used in zebrafish to cause symptoms similar to OP and to establish an OP model. Chemical staining with quercetin and alizarin red is a commonly used method in bone research. Staining with Alizarin Red, which can chelate calcium ions, is the most commonly used visualization method for zebrafish bone mineralization. However, this method has disadvantages, including cumbersome technical procedures (requires dyeing and the use of multiple reagents), time-consuming (long dyeing and bleaching process), unstable dye labeling (alizarin red does not always meet requirements Spread in fish). In this study, we tried to establish a glucocorticoid-induced OP (GIOP) model, and used bone transgenic zebrafish TG (ola.sp7:nlsGFP) to establish its evaluation program. The EGFP signal area and integrated optical density (IOD) were measured to reflect the bone mineralization area and bone density, respectively. This method has the advantages of convenience, efficiency and stability, and provides a powerful tool for high-throughput screening of anti-OP drugs.

　　Zebrafish culture: Embryos and larvae are cultured in an incubator with embryo water (5 mM Nacl, 0.17 mM KCl, 0.33 mM CaCl2, 0.33 mM MgSO4) at 28.5°C. Transgenic zebrafish: As mentioned above, the Tol2 transposon system is used to produce TG (ola.sp7:nlsGFP) transgenic zebrafish. Schulte-Merker laboratory provides pDestTol2cG2-osterix-nlseGFP-PA plasmid. .Identified by crossing it with wild-type zebrafish and screening F1 embryos expressing EGFP. In this study, homozygous embryos of the same adult fish expressing strong EGFP were used in the same set of experiments.

　　 induced zebrafish osteoporosis model: wild-type or transgenic larvae are cultured in a 12-well culture plate 4 days after fertilization (DPF). Add N-phenylthiourea to the embryo water to prevent pigmentation. In order to establish a GIOP model, embryos were exposed to dexamethasone at concentrations of 5, 10, and 20 μm to select the best effective concentration. In the rescue experiment, 1.0, 0.5 and 0.1μg/ml flavonoids extracted with FE and purity>90% were mixed with 10μN DEX to select the best effective concentration. DMSO (1:1000) and pure embryo water were used as the control group. Renew half the volume of embryo water every day (using DEX and/or iron). All experiments ended on the fifth day, and 8 DPF fish were collected for bone mineralization analysis. Each group has 18 embryos.

　　QRT-PCR: A total of 15 fish with 8 dpf in each group were used for qrt-PCR analysis. The total RNA was separated with Trizol and treated with DNase I. According to the manufacturer's instructions, 1000ng RNA is required to synthesize cDNA using the SYBR Green Real-time PCR Master Mix. The obtained cDNA was diluted 1:10 in DEPC-treated water for further experiments. The total volume of the qrt-PCR reaction is 20μl, including 10μl 2×sybr green real-time PCR master mix, 5μl diluted cDNA, 0.8μl primers and DEPC-treated water. This experiment used primers: osterix-Fw AAGAAACCTGTCCACAGCTG; osterix-Re GAGGCTTTACCGTACACCTT; osteocalcin-Fw TGGCCTCTATCATCATGAGACAGA; osteocalcin-Re CTCTCGAGCTGAAATGGAGTCA; eGFP-Fw GAAGAACGGCATCAAGGTG, eGFP-Re ACTGGGTGCTCAGGTAGTGG; osteopontin-Fw CGCTCAGCAAGCAGTTCAGA; osteopontin-Re AGAATAGGAGGTGGCCGTTGA; tracp-Fw CGTCCACTGACCACAGGAAGA,tracp-Re AAGGATCCTGACGTCTGATTGA; β-actin-Fw CAACAGGGAAAAGATGACACAGAT; and β-actin-Re CAGCCTGGATGGCAACGT. Imaging and evaluation of bone mineralization: zebrafish larvae were fixed in 4% paraformaldehyde (PFA) phosphate buffered saline (PBS). As mentioned earlier, zebrafish larvae are stained with Alizarin Red. Embryos were implanted and imaged with M205-FA stereo microscope. The gain, saturation, exposure and illumination level of each imaging process are the same. A laser scanning confocal microscope (LSCM) was used to reconstruct the transgenic zebrafish TG (ola.sp7:nlsGFP). LSCM imaging parameter settings are the same in all imaging processes of all fish schools. The pinhole is set to 1 AU, and the digital gain is set to 1.0; both the main gain and digital offset are set to the lowest to avoid overexposure. The Z-stack and internal depth settings use optimized section depths. Evaluate bone mineralization based on 3D reconstructed images, and use Image-Pro software for quantification. During density and IOD measurement, the eyedropper tool is used to repeatedly and accurately select the region of interest (ROI) until all ROIs are selected. For wild-type fish, the Alizarin Red staining area was measured as previously described. For transgenic fish, the fluorescent image is first inverted to a grayscale image. Then, the fluorescence area and IOD were measured in the same way as Alizarin Red stained the embryos, representing the degree of mineralization and BMD, respectively. When calculating the signal strength, the "measurement data" and "statistics" functions are used to perform t-test on the IOD results. Each group has 18 embryos.

　　Result: DEX-induced osteoporosis-like symptoms in TG (ola.sp7:nlsGFP) zebrafish: To produce cortical bone transgenic zebrafish, the pdesttol2c2-Osterix-nlseGFP-pa vector was injected into AB zebrafish embryos. In a series of developmental stages of TG (ola.sp7:nlsGFP) zebrafish, the expression pattern of eGFP that marks osteoblasts was studied. EGFP was initially detected in the head and tail regions of 1 DPF embryos. At 8 dpf, eGFP can be clearly seen in the cleft lip (CT), cap layer, mandible (MD) and branchial cleft (BR). From 30 to 42 dpf, eGFP strongly marked the cranial bones, spine, fins, tail and scales. The skull develops between 4 and 8 dpf. During this period, the structure and shape of the skull did not change significantly. In these developmental stages, there was no significant change in bone quality and bone density, which were reflected in the eGFP fluorescence area and IOD, respectively. Therefore, 4-8dpf zebrafish larvae were used in this study. Alizarin red chelates with calcium ions to label mineralized bone, which is the most commonly used method for studying bone mineralization. When comparing the early bone structure of the two methods, there are obvious differences, especially in the anterior notochord area, which is clearly stained with Alizarin Red, but there is still no mark at 8 dpf. To induce OP-like symptoms, 4 DPF zebrafish larvae were given different concentrations of DEX. In morphology, there was no significant difference between pure water-incubated embryos and DMSO-incubated zebrafish larvae. At 8 dpf, zebrafish treated with 5μM DEX showed a slight curve at the junction of the brain and trunk compared with the untreated or DMSO-treated control group. The increase in DEX concentration from 10 μm to 20 μm aggravated this performance. When comparing the cranial bone images by morphometrics, all the processed embryos showed similar structures in the Alizarin Red staining group and the TG (ola.sp7:nlsGFP) group. However, the signal intensity of DEX-treated larvae showed a downward trend in both alizarin red staining and green fluorescence. In these two groups, the mineralized area of larvae exposed to 5 μM DEX was significantly lower than that of DMSO-treated larvae. Increasing the concentration to 10 or 20 μm further enhanced this difference. The above results show that the evaluation method with EGFP area and IOD as parameters can reflect the level of bone mass loss. The results are consistent with the results of traditional Alizarin Red staining, suggesting that the zebrafish GIOP model was successfully established with TG (ola.sp7:nlsGFP) thread. Flavonoid therapy can save GIOP: Based on the successful establishment of the GIOP model, the model was treated with flavonoids extracted from the traditional Chinese medicine Epimedium (FE), which played an anti-op effect in the rat study, thus testing the model The clinical relevance of the model. Preliminary analysis of the effect of 1μg/ml FE on zebrafish bone growth showed that FE stimulation can increase bone quality, which is reflected in both the fluorescence zone and the IOD. In order to study the repairing effect of FE on the GIOP model, different concentrations of FE were mixed with 10μM DEX to test zebrafish larvae of 4-8dpf. As a result, the addition of 1 μg/ml FE mixture rescued zebrafish larvae from the curved body at the junction area of the brain and trunk. Morphological analysis of TG (ola.sp7:nlsGFP) images showed that, compared with the GIOP group, the fluorescence area and IOD of the larvae treated with 1μg/ml FE increased again. This shows that 1μg/mlFE treatment can significantly inhibit bone loss. These results are consistent with the image analysis of the traditional Alizarin Red staining group. The above results indicate that FE can prevent bone defects, suggesting that FE has a potential therapeutic effect on OP.

　　 Osteoblast transcription factor Osterix, osteocalcin, osteopontin, and osteoclast factor Tracp, which regulates bone and matrix formation, are reported to be involved in OP. Therefore, qrt-PCR was used to analyze the expression levels of homologous osteoblasts and osteoclast-related genes in GIOP zebrafish. Compared with the DMSO-treated control group, DEX treatment down-regulated the expression levels of osteopontin, osteocalcin and osteopontin, while the expression of TRACP was significantly up-regulated. Compared with the GIOP group, FE treatment up-regulated the expression of Osterix, osteocalcin and osteopontin, but had no effect on the expression of TRACP. In addition, consistent with the changes in eGFP protein expression in osteoblasts, in the GIOP model, the expression level of eGFP mRNA was also down-regulated.

　　Discussion: One limitation of our GIOP model is that since eGFP only labels osteoblasts, it cannot label osteoclasts when OP-like symptoms are formed. Therefore, this model can only be used to screen anti-OP drugs that have a direct effect on osteoblasts. It is not suitable for studying histopathology involving osteoclasts. However, compared with the traditional Alizarin Red staining method, the use of TG (ola.sp7:nlsGFP) zebrafish can easily assess bone quality and density through eGFP signal. It not only eliminates the tedious process of dyeing and bleaching, but also avoids unstable signals caused by chemical dyeing. Therefore, this model and related evaluation methods can be used for the screening of anti-OP drugs.